diff --git a/src/ga4gh/vrs/extras/translator.py b/src/ga4gh/vrs/extras/translator.py
index 6ed4e57f..05d2c205 100644
--- a/src/ga4gh/vrs/extras/translator.py
+++ b/src/ga4gh/vrs/extras/translator.py
@@ -496,6 +496,10 @@ def _from_hgvs(
         if not refget_accession:
             return None
 
+        # translate coding coordinates to positional coordinates, if necessary
+        if sv.type == "c":
+            sv = self.hgvs_tools.c_to_n(sv)
+
         location = models.SequenceLocation(
             sequenceReference=models.SequenceReference(
                 refgetAccession=refget_accession
diff --git a/tests/extras/cassettes/test_from_hgvs_coding_coordinates.yaml b/tests/extras/cassettes/test_from_hgvs_coding_coordinates.yaml
new file mode 100644
index 00000000..7010f6b9
--- /dev/null
+++ b/tests/extras/cassettes/test_from_hgvs_coding_coordinates.yaml
@@ -0,0 +1,39 @@
+interactions:
+- request:
+    body: null
+    headers: {}
+    method: GET
+    uri: http://localhost:5000/seqrepo/1/metadata/refseq:NM_001331029.1
+  response:
+    body:
+      string: "{\n  \"added\": \"2016-08-24T05:03:40Z\",\n  \"aliases\": [\n    \"MD5:a8d7243ffeea4ade1dbc33613887693b\",\n
+        \   \"NCBI:NM_001331029.1\",\n    \"refseq:NM_001331029.1\",\n    \"NCBI:XM_017001344.1\",\n
+        \   \"refseq:XM_017001344.1\",\n    \"SEGUID:qw9iIJ9BPdGZfypwQH7S3L2f9gI\",\n
+        \   \"SHA1:ab0f62209f413dd1997f2a70407ed2dcbd9ff602\",\n    \"VMC:GS_MBIgVnoHFw34aFqNUVGM0zgjC3d-v8dK\",\n
+        \   \"sha512t24u:MBIgVnoHFw34aFqNUVGM0zgjC3d-v8dK\",\n    \"ga4gh:SQ.MBIgVnoHFw34aFqNUVGM0zgjC3d-v8dK\"\n
+        \ ],\n  \"alphabet\": \"ACGT\",\n  \"length\": 11291\n}\n"
+    headers: {}
+    status:
+      code: 200
+      message: OK
+- request:
+    body: null
+    headers: {}
+    method: GET
+    uri: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NM_001331029.1&rettype=fasta&seq_start=250&seq_stop=350&tool=bioutils&email=biocommons-dev@googlegroups.com
+  response:
+    body:
+      string: '>NM_001331029.1:250-350 Homo sapiens protein phosphatase 1 regulatory
+        subunit 12B (PPP1R12B), transcript variant 8, mRNA
+
+        GAGCCTGCGGAGCGACGAGGCGCGGGGCGGCAGCCGCTGACCAGGCGCGGGAGCCCCAGGGTCCGCTTCG
+
+        AGGACGGTGCTGTCTTTCTGGCCGCCTGCTC
+
+
+        '
+    headers: {}
+    status:
+      code: 200
+      message: OK
+version: 1
diff --git a/tests/extras/test_cnv_translator.py b/tests/extras/test_cnv_translator.py
index a7a3fa0e..9c71ab55 100644
--- a/tests/extras/test_cnv_translator.py
+++ b/tests/extras/test_cnv_translator.py
@@ -173,3 +173,29 @@ def test_from_hgvs_cn_copies_zero(tlr):
     cn = tlr._from_hgvs("NC_000013.11:g.26440969_26443305del", copies=0)
     assert cn.type == "CopyNumberCount"
     assert cn.copies == 0
+
+
+@pytest.mark.vcr
+def test_from_hgvs_coding_coordinates(tlr):
+    """CDS-relative (``c.``) inputs are converted to transcript-relative
+    coordinates via ``c_to_n`` before the VRS location is built; without the
+    conversion the resulting ``SequenceLocation`` would point into the 5' UTR.
+    """
+    cx = tlr._from_hgvs("NM_001331029.1:c.100_200del")
+    assert cx.model_dump(exclude_none=True) == {
+        "id": "ga4gh:CX.lJiuo6QPsrSEKI7EeX0xpX5Iqx0R_Kal",
+        "type": "CopyNumberChange",
+        "digest": "lJiuo6QPsrSEKI7EeX0xpX5Iqx0R_Kal",
+        "location": {
+            "id": "ga4gh:SL.K0g9SmC4z2-ayJsTHFHuIAygGNv1UMgi",
+            "type": "SequenceLocation",
+            "digest": "K0g9SmC4z2-ayJsTHFHuIAygGNv1UMgi",
+            "sequenceReference": {
+                "type": "SequenceReference",
+                "refgetAccession": "SQ.MBIgVnoHFw34aFqNUVGM0zgjC3d-v8dK",
+            },
+            "start": 249,
+            "end": 350,
+        },
+        "copyChange": "loss",
+    }